View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_79 (Length: 239)
Name: NF3547_low_79
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 45609045 - 45609107
Alignment:
| Q |
1 |
ttgatttgctcttcacgagtccgccttgtttgtgaaacaaaaagatggaagaagtctttccct |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45609045 |
ttgatttgctcttcacgagtccgccttgtttgtgaaacaaaaagatggaagaagtctttccct |
45609107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 156 - 222
Target Start/End: Original strand, 45609200 - 45609266
Alignment:
| Q |
156 |
caacaggatgaggttgttttttgagagctagaactagaagatgtggataattgatcaagcttatctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45609200 |
caacaggatgaggttgttttttgagagctataactagaagatgtggataattgatcaagcttatctt |
45609266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University