View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_83 (Length: 238)
Name: NF3547_low_83
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_83 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 55 - 238
Target Start/End: Original strand, 40306745 - 40306935
Alignment:
| Q |
55 |
aattattgaaaactctattatagtagtgtcta-------gttacgatcttctccatttataaaatatagaagtttttgagagtatttgaaagtttcaaat |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
40306745 |
aattattgaacactctattatagtagtgtctatataggagttacgatcttctccatttataaaatatagaagcttttgagagtatttaaaagtttcaaat |
40306844 |
T |
|
| Q |
148 |
ttggttcaagatagatgtttttcggtggtgccggttcaaatggattctgaattgctcaaccatgtcattcaaggtgataagaaaagtatct |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40306845 |
ttggtttaagatagatgtttttcggtggtgccagttcaaatggattctgaattgctcaaccatgccattcaaggtgataagaaaagtatct |
40306935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 19753539 - 19753505
Alignment:
| Q |
1 |
cagaaccagcaacaacaggcatagtgttaggccaa |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19753539 |
cagaaccagcaacaacaggcatagtgttaggccaa |
19753505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 23169502 - 23169536
Alignment:
| Q |
1 |
cagaaccagcaacaacaggcatagtgttaggccaa |
35 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23169502 |
cagaaccagcaacaacaggcatagtattaggccaa |
23169536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 12700802 - 12700768
Alignment:
| Q |
1 |
cagaaccagcaacaacaggcatagtgttaggccaa |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12700802 |
cagaaccagcaacaacaggcataatgttaggccaa |
12700768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University