View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_88 (Length: 236)
Name: NF3547_low_88
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 96 - 218
Target Start/End: Complemental strand, 14335882 - 14335761
Alignment:
| Q |
96 |
aacctttctcattagttatcattagatacctctgttaatcttgttttcttcnnnnnnnccaaatttctttcatccctatactccttttcaagcattcgat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14335882 |
aacctttctcattagttatcattagatacctctgttaatcttgttttcttctttttt-ccaaatttctttcatccctatactccttttcaagcattcgac |
14335784 |
T |
|
| Q |
196 |
gttgaaaaaactttacacctatg |
218 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14335783 |
gttgaaaaaactttacacctatg |
14335761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University