View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_94 (Length: 219)
Name: NF3547_low_94
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_94 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 30184210 - 30184015
Alignment:
| Q |
9 |
cgaagaatatcatctttttctaaatttatctattaaaatgagaaataannnnnnnn-ctcgtctagatttcaccatttgaaaatatcttaggaataatct |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30184210 |
cgaaaaatatcatctttttctaaatttatctataaaaatgagaaatattttttttttctcgtctagatttcaccatttaaaaatatcttaggaataatct |
30184111 |
T |
|
| Q |
108 |
tctttcatttgtaaaacaattgtgtatttattcaaatccgaataaatgtgcacaagaattgttctctcctgaaatccaatcattcatatactatat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30184110 |
tctttcatttgtaaaacaattgtgtatttattcaaatccgaataaatgtgcacaagaattgttctctcttgaaatccaatcattcatatactatat |
30184015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University