View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_high_51 (Length: 235)
Name: NF3550_high_51
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 10241904 - 10242135
Alignment:
| Q |
1 |
ctgagacttcacatgctcgcaaacgaagggacaatcgatgtccacatgcttgatgcgttcatgacttataggattgagtt-gagatttgctatcgcaata |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| | |
|
|
| T |
10241904 |
ctgagacttcacatgctcgcaaatgaagggacaatcgatgtccacatgcttgatgcgttcatgacttataggatcgagtttgagatttgctatcgcaaaa |
10242003 |
T |
|
| Q |
100 |
cgtcatgaccgaagacatgggaccttaaaaactcgaagaatgagaaagattgggctgtttcttagatttccatgatatctaggtttagattggtttttat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10242004 |
tgtcatgaccgaagacatgggaccttaaaaactcgaagaatgagaaagattgggctgtttcttagatttccatgatatctaggtttagattggtttttat |
10242103 |
T |
|
| Q |
200 |
tcttgctcatgtcctcacaaaccacttaggta |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10242104 |
tcttgctcatgtcctcacaaaccacttaggta |
10242135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 10266235 - 10266297
Alignment:
| Q |
6 |
acttcacatgctcgcaaacgaagggacaatcgatgtccacatgcttgatgcgttcatgactta |
68 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| |||||||||| | | |||||||||||| |
|
|
| T |
10266235 |
acttcacattctcacaaatgaagggacaatcgatttccacatgctaggagagttcatgactta |
10266297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University