View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3550_high_63 (Length: 215)

Name: NF3550_high_63
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3550_high_63
NF3550_high_63
[»] chr6 (1 HSPs)
chr6 (16-199)||(73175-73358)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 73358 - 73175
Alignment:
16 ataggaaaggaaagaagttagttagttacttagcccaagcagggtaattgtgaacgcgttcttgttcgcgttcttgtttatcttgtctaattttaagcaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
73358 ataggaaaggaaagaagttagttagttacttagcccaagcagggtaattgtgaacgcgttcttgttcgcgttgttgtttatcttgtctaattttaagcaa 73259  T
116 tctccgacctctagcggtggttcctgatccttttatcgatttatcaatttcaccaccgttggatttggatttggaggatttaga 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
73258 tctccgacctctagcggtggttcctgatccttttatcgatttatcaatttcaccaccgtttgatttggatttggaggatttaga 73175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University