View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_high_63 (Length: 215)
Name: NF3550_high_63
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 73358 - 73175
Alignment:
| Q |
16 |
ataggaaaggaaagaagttagttagttacttagcccaagcagggtaattgtgaacgcgttcttgttcgcgttcttgtttatcttgtctaattttaagcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
73358 |
ataggaaaggaaagaagttagttagttacttagcccaagcagggtaattgtgaacgcgttcttgttcgcgttgttgtttatcttgtctaattttaagcaa |
73259 |
T |
 |
| Q |
116 |
tctccgacctctagcggtggttcctgatccttttatcgatttatcaatttcaccaccgttggatttggatttggaggatttaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
73258 |
tctccgacctctagcggtggttcctgatccttttatcgatttatcaatttcaccaccgtttgatttggatttggaggatttaga |
73175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University