View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_high_64 (Length: 213)
Name: NF3550_high_64
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 49449421 - 49449223
Alignment:
| Q |
1 |
aggagctatgtcttttgatgaaatatggaatgagataaacaacatcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttgg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49449421 |
aggagccatgtcttttgatgaaatatggaatgagataaacaacatcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttgg |
49449322 |
T |
 |
| Q |
101 |
aatgatcatttctttattttgaaggtagaggttgatgcttactatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49449321 |
aatgatcatttctttattttgaaggtagaggttgatgcttactatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtg |
49449223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University