View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_high_65 (Length: 201)
Name: NF3550_high_65
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_high_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 125
Target Start/End: Original strand, 21444104 - 21444216
Alignment:
| Q |
13 |
gagagaagaagtgaatgcacataattagatgaagttgatattacagggatgaacattttgatttaacttgctcaaaaacatattgaagttgctcaaaatt |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21444104 |
gagagaagaagtgaatgcagataattagatgaagttgatattacagggatgaacattttgatttaacttgctcaaaaacatattgaagttgctcaaaatt |
21444203 |
T |
|
| Q |
113 |
tcaatctttattt |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21444204 |
tcaatctttattt |
21444216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 125
Target Start/End: Complemental strand, 42066530 - 42066418
Alignment:
| Q |
13 |
gagagaagaagtgaatgcacataattagatgaagttgatattacagggatgaacattttgatttaacttgctcaaaaacatattgaagttgctcaaaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42066530 |
gagagaagaagtgaatgcacataattagatgaagttgatattacatggatgaacattttgatttaacttgctcaaaaacatattgaagttgctcaaaatt |
42066431 |
T |
|
| Q |
113 |
tcaatctttattt |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42066430 |
tcaatctttattt |
42066418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 13 - 125
Target Start/End: Complemental strand, 50012354 - 50012242
Alignment:
| Q |
13 |
gagagaagaagtgaatgcacataattagatgaagttgatattacagggatgaacattttgatttaacttgctcaaaaacatattgaagttgctcaaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50012354 |
gagagaagaagtgaatgcacataattagatgaagttgatattacagggatgaacattttgatttaacttgctcaaaaatatattgaagttgctcaaaatt |
50012255 |
T |
|
| Q |
113 |
tcaatctttattt |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
50012254 |
tcaatctttattt |
50012242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 21444234 - 21444272
Alignment:
| Q |
146 |
tcaatctttaatatttgaaaaacacttgcccacgttact |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21444234 |
tcaatctttaatatttggaaaacacttgcccacgttact |
21444272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 183
Target Start/End: Complemental strand, 50012221 - 50012184
Alignment:
| Q |
146 |
tcaatctttaatatttgaaaaacacttgcccacgttac |
183 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50012221 |
tcaatctttaatatttggaaaacacttgcccacgttac |
50012184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 183
Target Start/End: Complemental strand, 42066396 - 42066359
Alignment:
| Q |
146 |
tcaatctttaatatttgaaaaacacttgcccacgttac |
183 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
42066396 |
tcaatctttaatatttggaaaacatttgcccacgttac |
42066359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University