View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_29 (Length: 282)
Name: NF3550_low_29
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 255
Target Start/End: Complemental strand, 41717700 - 41717449
Alignment:
| Q |
5 |
gagtgagatgaaaatgagagtgttgatgacagcgatgaatttggcggcgattggttgctagaagaacccctattagggttttggtctatttagaacaaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41717700 |
gagtgagatgaaaatgagagtgttgatgacagcgatgaatttggcggcgattggttgctagaagaacccctattagggttttggtctatttagaacaaga |
41717601 |
T |
|
| Q |
105 |
ggattatatacactcatgaatcaatacagcaaaagcaaacccaacacaacacatatggttctttttgtgttttagacactaatcgagtcgttaacttaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
41717600 |
ggattatatacactcatgaatcaatacagcaaaagcaaacccaacacaacacatatggttctttttgtgttttagacaccagttgagtcgttaacttaac |
41717501 |
T |
|
| Q |
205 |
tc-atcgataaagataatgtataatatacgtaaagtttgagtttaaattctc |
255 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41717500 |
tcggttgataaagataatgtataatatacgtaaagtttgagtttaaattctc |
41717449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University