View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_39 (Length: 245)
Name: NF3550_low_39
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 29228313 - 29228535
Alignment:
| Q |
19 |
cctgatggtatgaatatatcaaatagtttttacttttaacatttagtacaagttcatgttggcatacaattaatttgtgattctatggaattggttttga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29228313 |
cctgatggtatgaatatatcaaatagtttttacttttaacatttagtacaagttcatgttggcatgcaattaatttgtgattctatggaattggttttga |
29228412 |
T |
 |
| Q |
119 |
tttataatgataattggttttcttctctactactctt------------atctacttcttcctccataattaggttattcctgttcaccactcttcccat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29228413 |
tttataatgataattggttttcttctctactactcttatctacttcttcatctacttcttcctccataattaggttattcctgttcaccactcttcccat |
29228512 |
T |
 |
| Q |
207 |
tttcctcacttgggacctcctat |
229 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
29228513 |
tttcctcactcgggacctcctat |
29228535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University