View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_40 (Length: 243)
Name: NF3550_low_40
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 13798857 - 13799074
Alignment:
| Q |
6 |
ttaactcacctcaaacttaaagttgtaagtttaactttcgttatcatcgtaagtactatattttttatggatgatatgccgttaccttggttccataaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
13798857 |
ttaactcacctcaaacttaaagttgtaagtttaactttcgttatcatcgtaagtactatattttttatggatgatatgcagttaccttggttctataaaa |
13798956 |
T |
|
| Q |
106 |
aatggacttattccatctcgacctccctttagtcaatcaaattatcattgatgagttatatctcatcagatatcttttagatgaccttgatttggccacc |
205 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
13798957 |
aatggatttattccatctcggtctccctttagtcaatcaaattatcactgaggagttatatctcatcggatatcttttagatgaccttgatttggtcacc |
13799056 |
T |
|
| Q |
206 |
tatgctcttaatgtattg |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13799057 |
tatgctcttaatgtattg |
13799074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University