View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_47 (Length: 238)
Name: NF3550_low_47
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 43987224 - 43987437
Alignment:
| Q |
19 |
ctttatttacattttcacccccttttcttcctctaattgtactcaatcattttcttcctgtttttgttgttgcagcgtgatgcttctttgtttttggtaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
43987224 |
ctttatttacattttcacccccttttcttcctctaattttactcaatcatcttcttcctgtt------gttgcagcttgatgcttctttgtttctggtaa |
43987317 |
T |
 |
| Q |
119 |
ttgaagtaggtcaatccttggttgtcgatgatcctgatggaaacttcactgttaccgcttttgatgccaatcactgtcctggttattttttcctttctaa |
218 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
43987318 |
ttgaagttggtcaatccttgattgtcgatgatcctgatggaaacttcaccgttaccgcttttgatgccaatcactgtccaggtaattttttcctttctaa |
43987417 |
T |
 |
| Q |
219 |
ttcttacaaccaatttctac |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43987418 |
ttcttacaaccaatttctac |
43987437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University