View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_54 (Length: 231)
Name: NF3550_low_54
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 13798549 - 13798738
Alignment:
| Q |
1 |
ttggaaggttagggttttgttgagagtgccggaggtgattgtccagttggtttgggaagtgtagtttgtaattgcatcatccatcgccatggatcaaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13798549 |
ttggaaggttagggttttgttgagagtgccggaggtgatggtccagttggtttgggaggtatagtttgcaattgcatcatccatcgccatggatcaaggt |
13798648 |
T |
 |
| Q |
101 |
ttctcaaagagtgtgaatcaagtgtagaaagggatttttcttttatacacagtctctctcttgtgaaaggagaaaaaaaattgggtttttgta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13798649 |
ttctcaaagagtgtgaatcaagtgtagaaagggatatttcgtttatacacag--tctctcttgtgaaaggag-aaaaaaattgggtttttgta |
13798738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University