View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_56 (Length: 229)
Name: NF3550_low_56
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 4235976 - 4236063
Alignment:
| Q |
18 |
agtttatcattttgttctaagttcttgc-ctatttttctgcatttttaccttctttcactttatttccttgctctttataattctgca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || |||||||||||| |||||| ||||||||| |
|
|
| T |
4235976 |
agtttatcattttgttctaagttcttgctctatttttctgcacttttaccttcctgcaatttatttccttgttctttacaattctgca |
4236063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 20685031 - 20685074
Alignment:
| Q |
61 |
tttaccttctttcactttatttccttgctctttataattctgca |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20685031 |
tttaccttcttgcactttatttccttgctctttataattctgca |
20685074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 47 - 104
Target Start/End: Complemental strand, 21516508 - 21516451
Alignment:
| Q |
47 |
tatttttctgcatttttaccttctttcactttatttccttgctctttataattctgca |
104 |
Q |
| |
|
|||||||||||| |||||| ||||| || |||||||| ||| ||||||||||||||| |
|
|
| T |
21516508 |
tatttttctgcacttttacattcttgcattttatttctttgtcctttataattctgca |
21516451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University