View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3550_low_61 (Length: 218)
Name: NF3550_low_61
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3550_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 4485173 - 4484988
Alignment:
| Q |
14 |
agagatgattaatgtgcaaaaggtgcaagtgattatagggataagcacacatggccagaagcagctataatggaagatataggaaacaaagctcaagttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4485173 |
agagatgattaatgtgcaaaaggtgcaagtgattatagggat--gcacacatggccagaagcagctataatggaagatataggaagcaaagctcaagttc |
4485076 |
T |
 |
| Q |
114 |
ctatcatatcctttgcagcacctaccataaccccaccgttgatgaataatcgatggccttttctggtgagactagctaacaatggtac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4485075 |
ctatcatatcctttgcagcacctaccattaccccacctttgatgaataatcgatggccttttctagtgagactagctaacaatggtac |
4484988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 4489340 - 4489155
Alignment:
| Q |
14 |
agagatgattaatgtgcaaaaggtgcaagtgattatagggataagcacacatggccagaagcagctataatggaagatataggaaacaaagctcaagttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||| || |||||| |||||||||||||| |
|
|
| T |
4489340 |
agagatgattaatgtgcaaaaggtgcaagtgattatagggat--gcaaacatggcaagaagcagctatggtggctgaagtaggaagcaaagctcaagttc |
4489243 |
T |
 |
| Q |
114 |
ctatcatatcctttgcagcacctaccataaccccaccgttgatgaataatcgatggccttttctggtgagactagctaacaatggtac |
201 |
Q |
| |
|
| |||||||||||| ||| |||||||| |||||||| |||||| | ||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
4489242 |
cagtcatatcctttgtagctcctaccattaccccaccattgatggaagctcggtggccttttctggtgagactagctaacactggtac |
4489155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University