View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3550_low_64 (Length: 213)

Name: NF3550_low_64
Description: NF3550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3550_low_64
NF3550_low_64
[»] chr3 (1 HSPs)
chr3 (1-199)||(49449223-49449421)


Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 49449421 - 49449223
Alignment:
1 aggagctatgtcttttgatgaaatatggaatgagataaacaacatcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttgg 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49449421 aggagccatgtcttttgatgaaatatggaatgagataaacaacatcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttgg 49449322  T
101 aatgatcatttctttattttgaaggtagaggttgatgcttactatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49449321 aatgatcatttctttattttgaaggtagaggttgatgcttactatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtg 49449223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University