View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3551_low_3 (Length: 266)
Name: NF3551_low_3
Description: NF3551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3551_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 133 - 243
Target Start/End: Complemental strand, 4278031 - 4277921
Alignment:
| Q |
133 |
actttcacaaaatagaaaaacatcatcacccttattggagccataccagtaggggtgagaatgatcgtacttacaacaagtacaagaaggtttggtgatg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4278031 |
actttcacaaaatagaaaaacatcatcacccttgctggagccatattagctggggtgggaatgatcgtacttacaacaagtacaagaaggtttggtgatg |
4277932 |
T |
 |
| Q |
233 |
gtgaagagaat |
243 |
Q |
| |
|
|| ||||||| |
|
|
| T |
4277931 |
atggagagaat |
4277921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University