View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3551_low_5 (Length: 248)
Name: NF3551_low_5
Description: NF3551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3551_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 139 - 228
Target Start/End: Original strand, 43831985 - 43832074
Alignment:
| Q |
139 |
ttcctatatgagaataatcatgatcaaccttcacggagagaagtttctcttcattctcagctaagccgttatttaccaactttgtagcca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43831985 |
ttcctatatgagaataatcatgatcaaccttcacggagagaagtttctcttcatcctcagctaagccgttatttaccaactttgtagcca |
43832074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 84 - 145
Target Start/End: Complemental strand, 43832223 - 43832162
Alignment:
| Q |
84 |
tattacgtatatagcttaagcttgttacgatgttccgataatattggtaaatctgttcctat |
145 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43832223 |
tattacgtatacagcttaagtttgttacgatgttccgataatattggtaaatctgttcctat |
43832162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 49
Target Start/End: Complemental strand, 43832251 - 43832222
Alignment:
| Q |
20 |
cacatataatagtggaattcatataactta |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43832251 |
cacatataatagtggaattcatataactta |
43832222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University