View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3552_high_7 (Length: 357)
Name: NF3552_high_7
Description: NF3552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3552_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 344
Target Start/End: Original strand, 11696194 - 11696520
Alignment:
| Q |
18 |
gtagcatggattatgcttgttcaatcttcactcagatcgatggaccgagtagttttgactataacacaatgattagaggaaatgttaatgacatgaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696194 |
gtagcatggattatgcttgttcaatcttcactcagatcgatgaaccgagtagttttgactataacacaatgattagaggaaatgttaatgacatgaaact |
11696293 |
T |
|
| Q |
118 |
agaagaagctttgttgctttatgttgatatgattgaaagaggtgttgagcctgataaattcacttatccttttgttttaaaggcttgttctttattaggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696294 |
agaagaagctttgttgctttatgttgatatgattgaaagaggtgttgagcctgataaattcacttatccttttgttttaaaggcttgttctttattaggc |
11696393 |
T |
|
| Q |
218 |
gtggtcgatgaaggaattcaagttcatggtcatgtttttaagatgggtcttgaaggtgatgtcattgtgcaaaatagtttgatcaacatgtatggtaagt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696394 |
gtggtcgatgaaggaattcaagttcatggtcatgtttttaagatgggtcttgaaggtgatgtcattgtgcaaaatagtttgatcaacatgtatggtaagt |
11696493 |
T |
|
| Q |
318 |
gtggggagataaagaatgcttgtgatg |
344 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11696494 |
gtggggagataaagaatgcttgtgatg |
11696520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University