View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3552_low_19 (Length: 237)
Name: NF3552_low_19
Description: NF3552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3552_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 29019230 - 29019056
Alignment:
| Q |
48 |
taacaggtttgtacttacaacatgtatttatcttttagatttaacgcttcctaacccttgcttccgttctgtatcataattctaattgttcacacatctg |
147 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||| ||| |
|
|
| T |
29019230 |
taacaggtttgtacttgcaacatgtgtttatcttttaggtttaacgcttcctaacccttgtttccgttctgcatcataaatctaattgttcacacagctg |
29019131 |
T |
 |
| Q |
148 |
-ctttaccctataggggatctattttcgatttatgtcggtatggaacaatagcgagtaatgtagatcatcataga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29019130 |
actttaccctataggggatctattttcgatttatgtcggtatggaacaatagcgagtaatgtagatcatcataga |
29019056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 111
Target Start/End: Original strand, 41218811 - 41218850
Alignment:
| Q |
72 |
tatttatcttttagatttaacgcttcctaacccttgcttc |
111 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41218811 |
tatttatcttttagatttagcgcttactaacccttgcttc |
41218850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 118
Target Start/End: Complemental strand, 33528094 - 33528048
Alignment:
| Q |
72 |
tatttatcttttagatttaacgcttcctaacccttgcttccgttctg |
118 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
33528094 |
tatttatcttttaagtttaacgcttgctaatccttgcttccgttctg |
33528048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 118
Target Start/End: Complemental strand, 39913313 - 39913264
Alignment:
| Q |
69 |
atgtatttatcttttagatttaacgcttcctaacccttgcttccgttctg |
118 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
39913313 |
atgtgtttatcttttaaatttagtgcttcctaactcttgcttccgttctg |
39913264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 123
Target Start/End: Original strand, 49044185 - 49044234
Alignment:
| Q |
74 |
tttatcttttagatttaacgcttcctaacccttgcttccgttctgtatca |
123 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||| ||| |||| |
|
|
| T |
49044185 |
tttatcttttaggtttagcgcttgctaacccttgcttccgtcctgcatca |
49044234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 118
Target Start/End: Complemental strand, 42071401 - 42071357
Alignment:
| Q |
74 |
tttatcttttagatttaacgcttcctaacccttgcttccgttctg |
118 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
42071401 |
tttatcttttaggtttagcgcttgttaacccttgcttccgttctg |
42071357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 118
Target Start/End: Complemental strand, 22572468 - 22572424
Alignment:
| Q |
74 |
tttatcttttagatttaacgcttcctaacccttgcttccgttctg |
118 |
Q |
| |
|
|||||||||||| |||| ||||| |||| |||||||||||||||| |
|
|
| T |
22572468 |
tttatcttttaggtttagcgcttgctaatccttgcttccgttctg |
22572424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University