View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3552_low_23 (Length: 227)
Name: NF3552_low_23
Description: NF3552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3552_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 36 - 219
Target Start/End: Complemental strand, 37156299 - 37156116
Alignment:
| Q |
36 |
attttaatataattacaaatgtcgatgtcgtgtgagtgttagacaccaccgaggctaaagtttattaagcacttgaacacaattttttatttcaatttaa |
135 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
37156299 |
attttattgtaattacaaatgtggatgtcgtgtcgatgttagacaccaccgaagttaaagtttattaagcacttgaacacaatttgttatttcaatataa |
37156200 |
T |
 |
| Q |
136 |
aatatgttattattttctagacaaattaaaatttcctagttaggttatgtttaaaaagaaattccaaattcaagaaggttgccc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37156199 |
aatatgttattattttctagacaaattaaaatttcctagttaggttatgtttaaaaagaaattccaaattcaagaaggttgccc |
37156116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University