View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3553_high_8 (Length: 312)
Name: NF3553_high_8
Description: NF3553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3553_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 30 - 312
Target Start/End: Original strand, 47116840 - 47117118
Alignment:
| Q |
30 |
gttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggaga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116840 |
gttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggaga |
47116939 |
T |
 |
| Q |
130 |
taaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47116940 |
taaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatt |
47117035 |
T |
 |
| Q |
230 |
tcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccgg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47117036 |
tcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccgg |
47117118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University