View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3553_high_9 (Length: 311)
Name: NF3553_high_9
Description: NF3553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3553_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 33152591 - 33152743
Alignment:
| Q |
1 |
tcgtcatcttcttcttcaaccgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctcgtgcccatcgatctcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33152591 |
tcgtcatcttcttcttcaaccgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctcatgcccatcgatctcac |
33152690 |
T |
|
| Q |
101 |
cttcagcactcaccaaccgcccagaagtactctcaggctcagcaaaatcccct |
153 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33152691 |
cttcagtactcaccaaccgcccagaagtactctcaggctcagcaaaatcccct |
33152743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University