View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_high_34 (Length: 279)
Name: NF3554_high_34
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 269
Target Start/End: Original strand, 25952428 - 25952681
Alignment:
| Q |
16 |
gttgtgatccgcaatcacaattgggtttaatcggtcgggcttaacccattttgtgagtaacgcatctgatgcattcgcgggtatagcaatgcattggacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25952428 |
gttgtgatccgcaatcacaattgggtttaatcggttgggcttaacccattttgtgagtaacggatcagatgcattcgcgggtatagcaatgcattggacc |
25952527 |
T |
 |
| Q |
116 |
tcattgcttcgcttgtcaacgactccagtgtagaggatgacaggtccttgacctgggatgatcgtggccgacccggaccaacaaccgtatttgtcaaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952528 |
tcattgcttcgcttgtcaacgactccagtgtagaggatgacaggtccttgacctgggatgatcgtggccgacccggaccaacaaccgtatttgtcaaagg |
25952627 |
T |
 |
| Q |
216 |
gtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952628 |
gtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttg |
25952681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 269
Target Start/End: Complemental strand, 42590512 - 42590422
Alignment:
| Q |
179 |
gtggccgacccggaccaacaaccgtatttgtcaaagggtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttg |
269 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||| |||||||| | ||||||| |||| ||||||| || || |||||||||| |
|
|
| T |
42590512 |
gtggctgacccggaccaacatccgtatttgtcgaagggtttagatgggtagatagcaggttcaagtgctttccagtttataagatcctttg |
42590422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University