View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_high_35 (Length: 272)
Name: NF3554_high_35
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 5755120 - 5755372
Alignment:
| Q |
1 |
tttaaagcatgtcacaacagtacttatgttactactctaattctagttttactttgtggcaagacaggatttaagaaggtttaagaaagtggtagagaga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5755120 |
tttaaagcatgtcacaacactacttatgttactactctaattctagttttactttgtggcaagacaggatttaagaaggtttaagaaagtggtagagaga |
5755219 |
T |
 |
| Q |
101 |
gagaataccaatttaaaacgttaatcccgcttccataaacccaacgtcactctttttgtcctgtttttctatttctaaccttcttgctcagcatatcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5755220 |
gagaataccaatttaaaacgttaatcccgcttccataaacccaacgtcactctttttgtcctgtttttctatttctaaccttcttgctcagcatatcata |
5755319 |
T |
 |
| Q |
201 |
tactacttgcatatcacttgagagaacagaacagaatagaaaaccatcaacat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5755320 |
tactacttgcatatcacttgagagaacagaacagaatagaaaaccatcaacat |
5755372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University