View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_high_45 (Length: 250)
Name: NF3554_high_45
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 7935973 - 7936206
Alignment:
| Q |
1 |
aataacagttatagcggaatttgaacagtagggagtcaaatactagcagaatttgaacaaaatgctattttctgcaatccttgaactagagggagcagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7935973 |
aataacagttatagcggaatttgaacagtagggagtcaaatactagcagaatttgaacaaaatgctattttctgcaatccttgaactagagggagcagtt |
7936072 |
T |
|
| Q |
101 |
catgaggtacaaatgaacaacaaaaacattgtataggggagtttgataacatacatgcctacagaatggtgagtaaaatacagttcagtgacatacttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7936073 |
catgaggtacaaatgaacaacaaaaacattgtataggggagtttgataacatacatgcctacagaatggtgagtaaaatacagttcagtgacatactaga |
7936172 |
T |
|
| Q |
201 |
attcacaacaaagcagtttgtctttctgtgtatg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7936173 |
attcacaacaaagcagtttgtctttctgtgtatg |
7936206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 1046659 - 1046695
Alignment:
| Q |
44 |
tagcagaatttgaacaaaatgctattttctgcaatcc |
80 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
1046659 |
tagcagaatttgaacaaactgttattttctgcaatcc |
1046695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 84
Target Start/End: Complemental strand, 40877095 - 40877056
Alignment:
| Q |
45 |
agcagaatttgaacaaaatgctattttctgcaatccttga |
84 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40877095 |
agcagaatttgaacaaactactattttctgcaatccttga |
40877056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 2643961 - 2643997
Alignment:
| Q |
44 |
tagcagaatttgaacaaaatgctattttctgcaatcc |
80 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
2643961 |
tagcagaatttgaacaaactgctatttactgcaatcc |
2643997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 21780919 - 21780955
Alignment:
| Q |
44 |
tagcagaatttgaacaaaatgctattttctgcaatcc |
80 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
21780919 |
tagctgaatttgaacaaactgctattttctgcaatcc |
21780955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 8600774 - 8600810
Alignment:
| Q |
44 |
tagcagaatttgaacaaaatgctattttctgcaatcc |
80 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
8600774 |
tagcagaatttgaacaaactgctattttccgcaatcc |
8600810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University