View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3554_high_53 (Length: 227)

Name: NF3554_high_53
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3554_high_53
NF3554_high_53
[»] chr8 (1 HSPs)
chr8 (1-227)||(26135185-26135411)
[»] chr2 (1 HSPs)
chr2 (13-209)||(25928128-25928324)
[»] scaffold0727 (1 HSPs)
scaffold0727 (91-209)||(2149-2267)


Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 26135185 - 26135411
Alignment:
1 gaatttatgctacctaaaggcctctacatgtggttattcttaccatcattgcatcgggacgctgataattggggaccagatgctacaaagttcaatccag 100  Q
    ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
26135185 gaatttatgctacctaaaggcatctacatgtggttattcttgccatcattgcatcgagacgctgataattggggaccagatgctacaaagttcaatccag 26135284  T
101 agagatttgctaacggtgtttctgcatcatgtaagtatcctcaggcatatataccatttggacttgggagtcgacattgtctaggtcaaaacttttccat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26135285 agagatttgctaacggtgtttctgcatcatgtaagtatcctcaggcatatataccatttggacttgggagtcgacattgtctaggtcaaaacttttccat 26135384  T
201 tacagaaatgaaggtagtactcagtct 227  Q
    |||||||||||||||||||||||||||    
26135385 tacagaaatgaaggtagtactcagtct 26135411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 25928324 - 25928128
Alignment:
13 cctaaaggcctctacatgtggttattcttaccatcattgcatcgggacgctgataattggggaccagatgctacaaagttcaatccagagagatttgcta 112  Q
    |||||||| |||||||| ||| | ||| | ||||   ||||||| ||| |||||||||||||||| ||||||||| | ||||| ||||| ||||||||||    
25928324 cctaaaggactctacatatggatgttcgtcccattgctgcatcgcgacactgataattggggaccggatgctacagaattcaagccagaaagatttgcta 25928225  T
113 acggtgtttctgcatcatgtaagtatcctcaggcatatataccatttggacttgggagtcgacattgtctaggtcaaaacttttccattacagaaat 209  Q
    | ||| |||||| | | |||||||||||||| || ||| |||||||||||  ||| |||||||||||  |||| ||||||||| || | ||||||||    
25928224 atggtctttctggagcttgtaagtatcctcaagcttatctaccatttggatatggaagtcgacattgcttaggccaaaactttaccctgacagaaat 25928128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0727 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0727
Description:

Target: scaffold0727; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 91 - 209
Target Start/End: Complemental strand, 2267 - 2149
Alignment:
91 ttcaatccagagagatttgctaacggtgtttctgcatcatgtaagtatcctcaggcatatataccatttggacttgggagtcgacattgtctaggtcaaa 190  Q
    ||||| ||||| ||||||||||| ||| |||||| | | |||||||||||||| || ||| |||||||||||  ||| |||||||||||  |||| ||||    
2267 ttcaagccagaaagatttgctaatggtctttctggagcttgtaagtatcctcaagcttatctaccatttggatatggaagtcgacattgcttaggccaaa 2168  T
191 acttttccattacagaaat 209  Q
    ||||| || | ||||||||    
2167 actttaccctgacagaaat 2149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University