View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_low_39 (Length: 259)
Name: NF3554_low_39
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 108 - 213
Target Start/End: Complemental strand, 2505041 - 2504936
Alignment:
| Q |
108 |
catgccccatgggaacacattggtaccacttgtttcaactcgatcactgattcaaagttaatgcctaaaacaaatgaactattaaaatagtccttaaact |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2505041 |
catgccccatgggaacacattggtaccacttgtttcaactcaatcactaattcaaagttaatgcctaaaacaaatgaactattaaaatagtccttaaact |
2504942 |
T |
|
| Q |
208 |
atcact |
213 |
Q |
| |
|
|||||| |
|
|
| T |
2504941 |
atcact |
2504936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 191 - 259
Target Start/End: Complemental strand, 2504925 - 2504857
Alignment:
| Q |
191 |
aaaatagtccttaaactatcactctctccaattttgtcctcaaacaatataaatatcataaatagcccc |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2504925 |
aaaaaagtccttaaactatcactctctccaatttcgtcctcaaacaatataaatatcataaatagcccc |
2504857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 2505167 - 2505130
Alignment:
| Q |
32 |
gttgttttgaacaattatctaaactgtcagacttacga |
69 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2505167 |
gttgttttgaacaattgtctaaactgtcagacttacga |
2505130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 195 - 246
Target Start/End: Complemental strand, 37641254 - 37641203
Alignment:
| Q |
195 |
tagtccttaaactatcactctctccaattttgtcctcaaacaatataaatat |
246 |
Q |
| |
|
||||||||||||||| |||||||||| ||| |||||||||| ||| |||||| |
|
|
| T |
37641254 |
tagtccttaaactattactctctccagtttagtcctcaaactataaaaatat |
37641203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University