View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_low_46 (Length: 245)
Name: NF3554_low_46
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 119 - 229
Target Start/End: Original strand, 44737528 - 44737637
Alignment:
| Q |
119 |
gttttgttgcaacgttagatttttgaagttttaacaaaaataacaatcaaagtaacattgtcattgtgatatcgtcaattatacactaatttgatatttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44737528 |
gttttgttgcaacgttagatttttgaagttttaacaaaaataacaatcaaagtaacattgtcattgtgatatcgtcaattatacactaatttgata-ttg |
44737626 |
T |
|
| Q |
219 |
atccatcatct |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
44737627 |
atccatcatct |
44737637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 44737252 - 44737349
Alignment:
| Q |
1 |
atacttatcattttcctttctgataaatttgagtagatttgtttcgtttggcatttagtaattttgagattatgagaaacatttttgaaagtacaagt |
98 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44737252 |
atacatatcatttcccttgctgataaatttgagtagatttgtttcgtttggcatttagtaattttgagattatgacaaacatttttgaaagtacaagt |
44737349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University