View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_low_52 (Length: 231)
Name: NF3554_low_52
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 38845351 - 38845148
Alignment:
| Q |
15 |
agagaaaaattgtaagtaaaaacaaaataggtatcttcgttaaaagctggactgcataaatgattatt-ataggttggattaaggtacttcaataaaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
38845351 |
agagaaaaattgtaagtaaaaacaaaataggtatcttcgttgaaagttggactgcataaatggttatttataggttggattaaggtacttcaacaaaaag |
38845252 |
T |
 |
| Q |
114 |
gaaattatcaccattagataaagtcttaaatgcctac--acaaatgacggttcttaatgtgggaatcaaacaaagaatctcttacttgctacaagcttat |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38845251 |
gaaattatcaccatcagataaagtcttaaatgcctactcacaaatgacggttcttaatgtggaaatcaaacaaagaatctcttacttgctacaagcttat |
38845152 |
T |
 |
| Q |
212 |
attt |
215 |
Q |
| |
|
|||| |
|
|
| T |
38845151 |
attt |
38845148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University