View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3554_low_56 (Length: 206)
Name: NF3554_low_56
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3554_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 19 - 118
Target Start/End: Complemental strand, 9993085 - 9992986
Alignment:
| Q |
19 |
tattagccattcttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttagtgcaactg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9993085 |
tattagccattcttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttggtgcaactg |
9992986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 118
Target Start/End: Original strand, 10441362 - 10441449
Alignment:
| Q |
31 |
ttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttagtgcaactg |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||| || | ||||| ||||||| | |||||| ||||||||| |
|
|
| T |
10441362 |
ttcacaaatcataatcttttacttaatagagtgatgtgtatggttttctagttaagtattgctcaaattcaggttcttggtgcaactg |
10441449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University