View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3554_low_56 (Length: 206)

Name: NF3554_low_56
Description: NF3554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3554_low_56
NF3554_low_56
[»] chr5 (2 HSPs)
chr5 (19-118)||(9992986-9993085)
chr5 (31-118)||(10441362-10441449)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 19 - 118
Target Start/End: Complemental strand, 9993085 - 9992986
Alignment:
19 tattagccattcttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttagtgcaactg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
9993085 tattagccattcttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttggtgcaactg 9992986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 118
Target Start/End: Original strand, 10441362 - 10441449
Alignment:
31 ttcactaatcataatcttttacttaatagattgatgtgtatggttttcattttcaatattggtcaaatttaagttcttagtgcaactg 118  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||   || | ||||| ||||||| | |||||| |||||||||    
10441362 ttcacaaatcataatcttttacttaatagagtgatgtgtatggttttctagttaagtattgctcaaattcaggttcttggtgcaactg 10441449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University