View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3555_high_7 (Length: 265)
Name: NF3555_high_7
Description: NF3555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3555_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 31222749 - 31222518
Alignment:
| Q |
19 |
ctaaggtgaaagacggagatgaccaagataaagcttatatgatatcaaaccctggttcggttttgagcatctgtcattgttgttgggcaaaagatggcaa |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31222749 |
ctaaggtgaaagacgaagatgaccaagataagacttatattgtatcgaaccctggttcaatgttgagcatctgtgattgttgttgggcaaaagatggcaa |
31222650 |
T |
 |
| Q |
119 |
cctttgtgagcataccttgaaagttcttagtatatgccgaagtatagggtctgttctgccatctatcagcttaatgcagtatcaccaggcgctaaataac |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | | |||||||| ||| || ||||| ||||||||||||||| ||||||||||||||||| |||| | | |
|
|
| T |
31222649 |
cctttgtgagcatatcttgaaagttcttagtgtcttccgaagtagaggatcagttctaccatctatcagcttattgcagtatcaccaggcgttaaaaagc |
31222550 |
T |
 |
| Q |
219 |
atgctgcattgcccaccttttgattctttaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31222549 |
atgctgcattgcccaccttttgattctttaat |
31222518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University