View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3555_low_12 (Length: 240)
Name: NF3555_low_12
Description: NF3555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3555_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 6500027 - 6500247
Alignment:
| Q |
1 |
tagacaaatcaacatcacttgaattattttcattatttgaagaaaacataggaacatcttccattactcctaatatcaatcggtccgaataacgtaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6500027 |
tagacaaatcaacatcacttgaattattttcattttttgaagaaaacataggaacatcttccattactcctaatatcaatcggtccgaataacgtaacat |
6500126 |
T |
|
| Q |
101 |
gcatttttcgtcttctgaccaaaaaatagcctcttttcgatttggacaattacgtgtgagatttgttctggcgctgctgaggcaactgcggcaactattc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6500127 |
gcatttttcatcttctgaccaaaaaatagcctcttttcgatttggacaattacgtgtgagatttgttctggcgctactgaggcaactgcggcaactattt |
6500226 |
T |
|
| Q |
201 |
ggcataatatcccctcggcat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6500227 |
ggcataatatcccctcggcat |
6500247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University