View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3556_high_10 (Length: 391)
Name: NF3556_high_10
Description: NF3556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3556_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 22 - 377
Target Start/End: Complemental strand, 43186375 - 43186018
Alignment:
| Q |
22 |
agaggtccggtgtatcctttaagattattttagtgtttatgatgaagaaaattatcagtttttatcatcattgttgttaaatagcagctgta--tagctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43186375 |
agaggtccggtgtatcctttaagattattttagtgtttatgatgaagaaaattatcagttgtaatcatcattgttgttaaatagcagctgtacatagctc |
43186276 |
T |
 |
| Q |
120 |
gtagcatagccaatttcaagcaaaccactcttctccgcgatctgcaatcgacaacagtggttatttttaaaccattcattttggcttaagttggatttac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186275 |
gtagcatagccaatttcaagcaaaccactcttctccgcgatctgcaatcgacaacagtggttatttttaaaccattcattttggcttaagttggatttac |
43186176 |
T |
 |
| Q |
220 |
caattgaaaaaaccaattgctaagatgttagtggttgttttagcttcataacatctgaagaaatgttgagttagcaaccattttccgctctgcgatgtag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
43186175 |
caattgaaaaaaccaattgctaagatgttagtggttgtttcagcttcataacatctgaagaaatgttgacttagcaaccattttccactctgcgatgtag |
43186076 |
T |
 |
| Q |
320 |
gttttccagaggttagagnnnnnnngcaacaagtgccaggcttgtgctcttcacaggt |
377 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43186075 |
gttttccagaggttagaggttttttgcaacaagtgccaggcttgtgctcttcacaggt |
43186018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University