View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3556_high_18 (Length: 239)
Name: NF3556_high_18
Description: NF3556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3556_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 41033910 - 41033699
Alignment:
| Q |
12 |
agcacagagcttgttattccaataaaacaccccattgtctaaatttgtttcatctttctttgctgatnnnnnnnnttgagttgcatttgcaagataatca |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41033910 |
agcactgagcttgttattccaataaaacacccctttgtctaaatttgtttcatctttctttgctgataaaaaaaattgagttgcatttgcaagataatca |
41033811 |
T |
|
| Q |
112 |
gtgtttttagtagcaagaaacaaccaagtagctccccaagccaactcatctttgtaactagttgagttataaagcattcttgcttgttttccacatgcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41033810 |
gtgtttttagtagcaagaaacaaccaagtagctccccaagccaactcatctttgtaactagttgagttataaagcattcttgcttgttttccacatgcat |
41033711 |
T |
|
| Q |
212 |
caacagcggtgt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41033710 |
caacagcggtgt |
41033699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University