View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3556_low_17 (Length: 258)
Name: NF3556_low_17
Description: NF3556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3556_low_17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 41 - 258
Target Start/End: Original strand, 44079506 - 44079724
Alignment:
| Q |
41 |
tgtaaatgtgagagacacgtaatatgagaa-agaagtacataatttcgactatttccaacctgaactttgacctctgtcttgtattgatatgtacagttg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079506 |
tgtaaatgtgagagacacgtaatatgagaagagaagtacataatttcgactatttccaacctgaactttgacctctgtcttgtattgatatgtacagttg |
44079605 |
T |
|
| Q |
140 |
cacgagatcttatttaagtttgttattatcatgtgaaatagtatgcttgacaatttatcatgcacgtagtaaatgttttgaagaatcatatcaactttgg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079606 |
cacgagatcttatttaagtttgttattatcatgtgaaatagtattcttgacaatttatcatgcacgtagtaaatgttttgaagaatcatatcaactttgg |
44079705 |
T |
|
| Q |
240 |
tgtgttaaaaacttaaata |
258 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
44079706 |
tgttttaaaaacttaaata |
44079724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University