View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3556_low_21 (Length: 233)
Name: NF3556_low_21
Description: NF3556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3556_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 39 - 225
Target Start/End: Complemental strand, 424763 - 424576
Alignment:
| Q |
39 |
gagaaggtatcagcaccatacgacatccattcaaaaatgattacctctaattaagtgcacaaatatttatattccccttattattatgggaattaaaatt |
138 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
424763 |
gagaaggtattagcaccatacgacatccattcaaaaatgattacctctaattaagtgcacaaatatttatattccccttattattatgggaattaaaatt |
424664 |
T |
 |
| Q |
139 |
gatttattttaggtgaaaatgttttgtttttaagtagaaggaataattattattattgtattcgtcaagagtgatctc-tgctcctac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
424663 |
gatttattttaggtgaaaatgttttgtttttaagtagaaggaataattattattattgtattcgtcaagagtgatctcttgctcctac |
424576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University