View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3557_low_3 (Length: 244)
Name: NF3557_low_3
Description: NF3557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3557_low_3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 21460441 - 21460212
Alignment:
| Q |
18 |
atgttaatctaaatattgcccataatcatcatatatctcaagcacagacggtgaaggaagctaagtaattataactaagttatgatcctagcatctggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21460441 |
atgttaatctaaatattgcccataatcatcatatatctcaagcacagacggtgaaggaagctaagtaattataactaagttatgatcctagcatctgatt |
21460342 |
T |
|
| Q |
118 |
atacattagattttattataatttgcaactgatactcatgcaaattttcttatatatataatcaaatctaagt---nnnnnnngaaacaatactaatgca |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21460341 |
atacattagattttattataatttgtaactgatactcatgcaaattttcttatatatataatcaaatctaagtaaaaaaaaaagaaacaatactaatgca |
21460242 |
T |
|
| Q |
215 |
taagcataaattacttctgagtctaatttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21460241 |
taagcataaattacttctgagtctaatttt |
21460212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 231
Target Start/End: Complemental strand, 42949950 - 42949865
Alignment:
| Q |
144 |
aactgatactcatgcaaattttcttatatatataatcaaatctaagtnnnnnnngaaacaatactaatgcataagcataaattacttc |
231 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| ||| ||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
42949950 |
aactgatactcatgcaaattttat--tatatataatcaaatctcagtaataaaggaaacaacactaatgcataagcatacatttcttc |
42949865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University