View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3559_low_16 (Length: 315)
Name: NF3559_low_16
Description: NF3559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3559_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 40166079 - 40165791
Alignment:
| Q |
20 |
gtggcctccgatccaaaacaaaacattttcgtacacgacactcaccttgatacagcagcagatggtcgatcgggatgtgtaacttacaagaacacaatag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40166079 |
gtggcctccgatccaaaacaaaacattttcgtacacgacactcaccttgatacagcagcagatggtcgatcgggatgtgtaacttacaagaacacaatag |
40165980 |
T |
 |
| Q |
120 |
atctaaagttaaagacaactctttgnnnnnnnnnnnnnnnnnncacaccgtataatattgcaacttttctgatattcttgcgttttaattcactatttga |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40165979 |
atctaaagttaaagacaactctttgtttttttaatttatttttcacaccgtataatattgcaacttttctgatattcttgcgttttaattcactatttga |
40165880 |
T |
 |
| Q |
220 |
caaaatggtgaggaaacttagaacacattttttccggaaaaggaggaggaaaattgctcatcaacgttgcctttaccttattcatctca |
308 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40165879 |
caaaatggtgaggaaacttggaacacattttttccggaaaaggaggaggaaaattgctcatcaacgttgcctttaccttattcatctca |
40165791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University