View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3559_low_17 (Length: 263)
Name: NF3559_low_17
Description: NF3559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3559_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 260
Target Start/End: Complemental strand, 45661446 - 45661207
Alignment:
| Q |
21 |
atcccaaccaaaaaccctaattcaaacccttttagtttcacccaattcaactaattcttttgaatctttgnnnnnnnctttctcacccaaatcgaagttc |
120 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
45661446 |
atcccaaccaaaaaccctaattcgaacccttttagtttcacccaattcaactaattcttttgaacctttgtttttttctttctcacccaaatcgaagttc |
45661347 |
T |
 |
| Q |
121 |
cgaatttgaaattcatcatccccaaaaaatgggaaatcctcctcgtgaaatcgacgattacatcttcaaacaacgcaagcttcatgaatcccaagaatca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45661346 |
cgaatttgaaattcatcatccccaaaaaatgggaaatcctcctcgtgaaatcgacgattacatcttcaaacaacgcaagcttcatgaatcccaagaatca |
45661247 |
T |
 |
| Q |
221 |
caaaaataccttcgtgaacaaaacctttctctgctcctcc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45661246 |
caaaaataccttcgtgaacaaaacctttctcttctcctcc |
45661207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University