View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3559_low_18 (Length: 251)
Name: NF3559_low_18
Description: NF3559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3559_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 251
Target Start/End: Original strand, 39723543 - 39723784
Alignment:
| Q |
5 |
gaggagcagagactcagttatgtgttcgggcggttgcggtcaagaggaaacgatcaatcatctattcttggagtatgacnnnnnnnnnnnnnnagtatat |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39723543 |
gaggagcagtgactcagttatgtgttcgggcggttatggtcaagaggaaacgatcaatcatctattcttggagtatgactttttttttt----agtatat |
39723638 |
T |
 |
| Q |
105 |
gacatcttgttcatcgttggtttggtatttttacagttgttccaccagatatttggtgttatgcatcgcaatttgtttggtgtgcatgctttcaaaaagg |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| | ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
39723639 |
gacatcttgttcatcgttggttgggtatttttacagttgttccaccaaatatttggtgttatgcgt-gcaatttttttggcgtgcatgctttcaaaaagg |
39723737 |
T |
 |
| Q |
205 |
acaatcatttatgctttcgggttatgtgcttggcttatctttggttc |
251 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39723738 |
aaaatcatttatgcttttaggttatgtgcttggcttatctttggttc |
39723784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 8387576 - 8387638
Alignment:
| Q |
21 |
gttatgtgttcgggcggttgcggtcaagaggaaacgatcaatcatctattcttggagtatgac |
83 |
Q |
| |
|
|||||||| || ||||| |||| ||||||||||| ||| |||| |||||||||||||| |||| |
|
|
| T |
8387576 |
gttatgtgctcaggcggctgcgctcaagaggaaatgattaatcctctattcttggagtgtgac |
8387638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University