View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3559_low_21 (Length: 236)
Name: NF3559_low_21
Description: NF3559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3559_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39723813 - 39724039
Alignment:
| Q |
1 |
ttgcaacaaaatgtagtctcatgatcaacttctggatagttgatcataaacaggattttacttttgattttcactttatgtggtctttagtagcactcta |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39723813 |
ttgcaacaaaatgtagtcccatgatcaacttctggattat-gatcataaacaggattttacttttgattttcactttatgtggtctttagtagcactcta |
39723911 |
T |
|
| Q |
101 |
tataggttataccacaactttgtaatcggggtccttgtttttg------ttattattttgacattttgtaatgtttctctttaggcatatcttacgttca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
39723912 |
tataggttataccacaactttgtaatcgtggttcttgtttttgttatctttattattttgacattttgtaatgtttctctttaggcacatcttacggtca |
39724011 |
T |
|
| Q |
195 |
attgagatgattttttaatggaaaatgt |
222 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
39724012 |
attgagatgattttttaatgggaaatgt |
39724039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University