View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3561_high_7 (Length: 288)
Name: NF3561_high_7
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3561_high_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 5162058 - 5161778
Alignment:
| Q |
7 |
aaaagtatatctatgttgactgaaaatacacgttgtattgactgacct----cagactgttatatgatatctctttcggttaaaaaatcttcatcttcat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5162058 |
aaaagtatatctatgttgactgaaaatacacgttgtattgactgacctgtctcagactgttatatgatatctctttcggttagaaaatcttcatcttca- |
5161960 |
T |
 |
| Q |
103 |
cttcagatctaacaagcataagtaaacagtagctaccaatggacaaggttagtgagtttcgttttcagtctcttagactcttacagatcttcatcgtcag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5161959 |
-----gatctaacaagcataagtaaacagtagctaccaatggacaaggttagtgagtttcgttttcagtctcttagactcttacagatcttcatcgtcag |
5161865 |
T |
 |
| Q |
203 |
cttcgctttgtgttgt-cactgatgcaatattattattctttctttattcttgaattagctaaaagcaaaggaggaagcagcctcat |
288 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5161864 |
cttcgctttgtgttgtccactgatgcaatattattattctttctttattcttgaattagctaaaagcaaaggaggaaccagcctcat |
5161778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University