View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3561_low_12 (Length: 250)
Name: NF3561_low_12
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3561_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 34647585 - 34647348
Alignment:
| Q |
12 |
aaaggtaagagtaaaaatatcaaaatagaaatacgtttattnnnnnnnnntagaaatgcaagatcattaattcttcaatgtatgaatgatgtgccaaaaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34647585 |
aaagataagagtaaaaatatcaaaatagaaatacgtttattaaaaaaaa-tagaattgcaagatcattaattcttcaatgtatgaatgatgtgcccaaaa |
34647487 |
T |
|
| Q |
112 |
attcccctggtgtccattatattgtcctgttgccggttgttactacttgtgttggttatgctcgtgtcaatcgagtcacacagggcctcttaattgtagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647486 |
attcccctggtgtccattatattgtcctgttgccggttgttactacttgtgttggttatgctcgtgtcaatcgagtcacacagggcctcttaattgtagc |
34647387 |
T |
|
| Q |
212 |
catcgattttattgtttttgtccatataaatattttaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647386 |
catcgattttattgtttttgtccatataaatattttaac |
34647348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University