View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3561_low_14 (Length: 235)
Name: NF3561_low_14
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3561_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 9576673 - 9576480
Alignment:
| Q |
14 |
aatataataactgtaaccaaaagttaggtctaacgatcgcatggtgccatgggagcggaaaaatcagtttaggtttataaattaaacctaataattttgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9576673 |
aatataataactgtaaccaaaagttaggtctaatgatcgcatggtgccatgggagcggaaaaatcagtttaggtttataaattaaacctaataattttgt |
9576574 |
T |
|
| Q |
114 |
ttctacaaatccaataatccaattactgcaaaaaagtttttccacagagataacgcttaacaggctttctcaggcttctctcaactcgttccgcttgtct |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9576573 |
ttctacaaatccaataatccaattgctgcaaaaaagtttttccacagagataacgcttaacag----------gcttctctcaactcgttccgcttgtct |
9576484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University