View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3561_low_8 (Length: 281)
Name: NF3561_low_8
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3561_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 265
Target Start/End: Original strand, 36109154 - 36109400
Alignment:
| Q |
9 |
gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggcattgtccgttttaggtgtgtatgatacg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36109154 |
gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggtattgtccgttttaggtgtgtatgatacg |
36109253 |
T |
 |
| Q |
109 |
ctttggcttgtgtctcaacttctaaataatgtgggactattttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36109254 |
ctttggcttgtgtctcaacttctaaata----------attttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta |
36109343 |
T |
 |
| Q |
209 |
atgttgattaattctttattaattcannnnnnnacagattctatgcatcagaagtgt |
265 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36109344 |
atgttgattaattctttattaattcatttttttacagattctatgcatcagaagtgt |
36109400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University