View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3561_low_9 (Length: 260)
Name: NF3561_low_9
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3561_low_9 |
 |  |
|
| [»] scaffold0365 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 242
Target Start/End: Complemental strand, 2312 - 2084
Alignment:
| Q |
14 |
agatagcaagattaacataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2312 |
agatagcaagattaacataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaat |
2213 |
T |
 |
| Q |
114 |
atcaataaggtgttcaaggaaagttccatgtttgtgccaacattcggatgcaccaaccgaacggaggattgtgattagggaagggaggttggcgtcaatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||| || ||| |
|
|
| T |
2212 |
atcaataaggtgttcaaggaaagttccatgtttgtgccaacattcagatgcaccaacagaacggaggattgtgattagggaagggagtttgggatcgatg |
2113 |
T |
 |
| Q |
214 |
gaattgagctcgttacggaggaagggttt |
242 |
Q |
| |
|
||| ||||||||||||| ||||||||||| |
|
|
| T |
2112 |
gaaatgagctcgttacgaaggaagggttt |
2084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 17341 - 17291
Alignment:
| Q |
155 |
attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg |
205 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
17341 |
attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg |
17291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 14492743 - 14492793
Alignment:
| Q |
155 |
attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg |
205 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14492743 |
attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg |
14492793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University