View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3561_low_9 (Length: 260)

Name: NF3561_low_9
Description: NF3561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3561_low_9
NF3561_low_9
[»] scaffold0365 (2 HSPs)
scaffold0365 (14-242)||(2084-2312)
scaffold0365 (155-205)||(17291-17341)
[»] chr1 (1 HSPs)
chr1 (155-205)||(14492743-14492793)


Alignment Details
Target: scaffold0365 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 242
Target Start/End: Complemental strand, 2312 - 2084
Alignment:
14 agatagcaagattaacataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2312 agatagcaagattaacataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaat 2213  T
114 atcaataaggtgttcaaggaaagttccatgtttgtgccaacattcggatgcaccaaccgaacggaggattgtgattagggaagggaggttggcgtcaatg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||  || |||    
2212 atcaataaggtgttcaaggaaagttccatgtttgtgccaacattcagatgcaccaacagaacggaggattgtgattagggaagggagtttgggatcgatg 2113  T
214 gaattgagctcgttacggaggaagggttt 242  Q
    ||| ||||||||||||| |||||||||||    
2112 gaaatgagctcgttacgaaggaagggttt 2084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 17341 - 17291
Alignment:
155 attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg 205  Q
    ||||||||||||| || |||||||||| ||||||| |||||||||||||||    
17341 attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg 17291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 14492743 - 14492793
Alignment:
155 attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg 205  Q
    ||||||||||||| || |||||||||| ||||||| |||||||||||||||    
14492743 attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg 14492793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University