View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_high_13 (Length: 274)
Name: NF3562_high_13
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_high_13 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 8636017 - 8635744
Alignment:
| Q |
1 |
agggtggtgacagcaccatgtccatagagttgagaaaaaagaagggttgtttgggatggaaattgatgagtgatagttgttgaggaatgtgagatagaag |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8636017 |
agggtggtgatagcaccatgtccatagagttgagaaaaaagaagggttgtttgggatggaaattgatgagtgatagttgttgaggaatgtgagatagaag |
8635918 |
T |
|
| Q |
101 |
atgattgatggaagaggaactaatattgctatgatagcattcttcaaattttgattacaaaccattgtgtcttggtttgtgtgtgtgtttttgtgaccag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8635917 |
atgattgatggaagaggaactaatattgctatgatagcattcttcaaattttgattacaaaccattgtgtcttggtttgtgtgtgtgtttttgtgaccag |
8635818 |
T |
|
| Q |
201 |
ttgagttccaattttatagttgcacttgattttgaatatcttttgcctggaccaatcagaaatcaaactgtttt |
274 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8635817 |
ttgagttccaattttatagttggacttgattttgaatatcttttgcctggaccaatcagaaatcaaactgtttt |
8635744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 139 - 178
Target Start/End: Complemental strand, 8643594 - 8643555
Alignment:
| Q |
139 |
attcttcaaattttgattacaaaccattgtgtcttggttt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8643594 |
attcttcaaatcttgattacaaaccattatgtcttggttt |
8643555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University