View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_high_14 (Length: 272)
Name: NF3562_high_14
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 52844416 - 52844656
Alignment:
| Q |
20 |
tgagtaatattattcccgttcttgttatatgcttggtgattttatttatctattgttatggtggctgatcaaaatttcatttttgtttttcatcaatgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52844416 |
tgagtaatattattcccgttcttgttatatgcttggtgattttatttatctattgttatggtggctgatcaaaatttcatttttgtttttcatcaatgaa |
52844515 |
T |
|
| Q |
120 |
ttttaatctcagctagcattttcgcgtatgggcaaacaagcagtggaaagacatataccatgactggaattactgaacttgcagtgaaggatatctatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52844516 |
ttttaatctcagctagcattttcgcgtatgggcaaacaagcagtggaaagacatataccatgactggaattactgaacttgcagtgaaggatatctatga |
52844615 |
T |
|
| Q |
220 |
atacatagaaaaggtataaaacaatttgaatagacgatatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52844616 |
atacatagaaaaggtataaaacaatttgaatagacgatatt |
52844656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 27277964 - 27278037
Alignment:
| Q |
128 |
tcagctagcattttcgcgtatgggcaaacaagcagtggaaagacatataccatgactggaattactgaacttgc |
201 |
Q |
| |
|
||||| || ||||| || |||||||||||||||||||||||||||||||| ||| |||||| |||||| |||| |
|
|
| T |
27277964 |
tcagcgagtatttttgcatatgggcaaacaagcagtggaaagacatatactatggttggaataactgaatttgc |
27278037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 195
Target Start/End: Original strand, 32260657 - 32260724
Alignment:
| Q |
128 |
tcagctagcattttcgcgtatgggcaaacaagcagtggaaagacatataccatgactggaattactga |
195 |
Q |
| |
|
||||| ||||| || || ||||| ||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
32260657 |
tcagcaagcatatttgcatatggacaaacaagcagtggaaagacatacaccatgagtggtattactga |
32260724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University