View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_high_17 (Length: 249)
Name: NF3562_high_17
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 9783383 - 9783244
Alignment:
| Q |
1 |
caaaatcaaattcttgggaacaatgcggtagatattaaatgaggt-agtaacaatgacaaagatcgtttaaacaaaggagt-------aaaagtgaacac |
92 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
9783383 |
caaaatcaaatttttgggaacaatgcggtagatatcaaatgaggtaagtaacaatgacaaagatcgtttaaacaaaggagttgaggaaaatagtgaacac |
9783284 |
T |
|
| Q |
93 |
tataatactttaaagtttgattagatatgtatctaccatc |
132 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9783283 |
tagaatactttaaagtttgattagatatgtatctaccatc |
9783244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 212 - 242
Target Start/End: Complemental strand, 9783161 - 9783131
Alignment:
| Q |
212 |
acagagcatcatatgacattttgcctatgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9783161 |
acagagcatcatatgacattttgcctatgtt |
9783131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University